or
or
Exact

Results for "KLHL1"

Variant Events: 29

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
KLHL1     Cukier2014:17342chr13:
70370894-70370894
TCexonicUnknownnonsynonymous SNVNM_001286725
NM_020866
c.A1432G
c.A1615G
p.M478V
p.M539V
19.49-Cukier2014 E
KLHL1     12529.p1 Complex Event; expand row to view variants  De novo--Turner2016 G
Turner2016 G
KLHL1     1-0010-005chr13:
70438563-70438563
CAintronicDe novo--Yuen2017 G
KLHL1     1-0271-004chr13:
70470230-70470230
CTintronicDe novo--Yuen2017 G
KLHL1     1-0148-005chr13:
70390370-70390370
ACintronicDe novo--Yuen2017 G
KLHL1     AU031003chr13:
70455255-70455255
TCintronicDe novo--Yuen2017 G
KLHL1     1-0325-003chr13:
70632103-70632109
CAGAATACAintronicDe novo--Yuen2017 G
KLHL1     7-0250-003chr13:
70545429-70545452
TATCATCATCATCATCATCATCATTATCATCATCATCATCATCATintronicDe novo--Yuen2017 G
KLHL1     AU3900301chr13:
70452488-70452488
GTintronicDe novo--Yuen2017 G
KLHL1     AU2950302chr13:
70551080-70551080
ATintronicDe novo--Yuen2017 G
KLHL1     3-0661-000chr13:
70490315-70490315
GAintronicDe novo--Yuen2017 G
KLHL1     1-0338-005chr13:
70637827-70637827
AGintronicDe novo--Yuen2017 G
KLHL1     2-1381-003chr13:
70444739-70444739
GCintronicDe novo--Yuen2017 G
KLHL1     AU3937301chr13:
70362248-70362248
AGintronicDe novo--Yuen2017 G
KLHL1     AU3632301chr13:
70455361-70455361
TCintronicDe novo--Yuen2017 G
KLHL1     AU3371303chr13:
70439779-70439779
CTintronicDe novo--Yuen2017 G
KLHL1     152-HSC0079chr13:
70514228-70514228
ATexonicInheritednonsynonymous SNVNM_001286725
NM_020866
c.T775A
c.T958A
p.F259I
p.F320I
32.0-Patowary2019 E
KLHL1     2-1567-003chr13:
70524318-70524318
CTintronicDe novo--Yuen2017 G
KLHL1     iHART1339chr13:
70681596-70681596
GTexonicMaternalstopgainNM_001286725
NM_020866
c.C236A
c.C236A
p.S79X
p.S79X
41.0-Ruzzo2019 G
KLHL1     iHART2142chr13:
70549929-70549929
GTexonicPaternalstopgainNM_020866c.C503Ap.S168X42.01.664E-5Ruzzo2019 G
KLHL1     iHART1340chr13:
70681596-70681596
GTexonicMaternalstopgainNM_001286725
NM_020866
c.C236A
c.C236A
p.S79X
p.S79X
41.0-Ruzzo2019 G
KLHL1     5-0083-003chr13:
70619725-70619725
CGintronicDe novo--Yuen2017 G
KLHL1     AU3371301chr13:
70473147-70473147
CTintronicDe novo--Yuen2017 G
KLHL1     12854.p1chr13:
70549704-70549704
CGintronicDe novo--Satterstrom2020 E
KLHL1     2-1277-004chr13:
70475839-70475839
ATintronicDe novo--Yuen2017 G
KLHL1     7-0044-003chr13:
70579264-70579264
CTintronicDe novo--Yuen2017 G
KLHL1     2-1510-003chr13:
70364157-70364163
CTATTTACTAintronicDe novo--Yuen2017 G
KLHL1     2-1522-003chr13:
70581787-70581787
TCintronicDe novo--Yuen2017 G
KLHL1     2-1292-003chr13:
70568516-70568516
CTintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More