or
or
Exact

Results for "MDM1"

Variant Events: 9

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
MDM1     2-1195-003chr12:
68820605-68820605
GAintergenicDe novo--Yuen2017 G
MDM1     Lim2017:70327chr12:
68696451-68696451
GTexonicDe novononsynonymous SNVNM_001205028
NM_017440
c.C1816A
c.C1921A
p.P606T
p.P641T
15.67-Lim2017 E
MDM1     13365.p1chr12:
68696451-68696451
GTexonicMosaic, De novononsynonymous SNVNM_001205028
NM_017440
c.C1816A
c.C1921A
p.P606T
p.P641T
15.67-Dou2017 E
Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Krupp2017 E
Satterstrom2020 E
Wilfert2021 G
MDM1     AU2787301chr12:
68736122-68736122
CAintergenicDe novo--Yuen2017 G
MDM1     1-0454-003chr12:
68765276-68765290
CGTGTGTGTGTGTGTCGTGTGTGTGTGTintergenicDe novo--Yuen2017 G
MDM1     Cukier2014:37232chr12:
68720534-68720534
AGexonicUnknownnonsynonymous SNVNM_001205028
NM_017440
NM_020128
c.T401C
c.T401C
c.T401C
p.V134A
p.V134A
p.V134A
6.0360.0174Cukier2014 E
MDM1     1-0332-003chr12:
68745258-68745258
GAintergenicDe novo--Yuen2017 G
MDM1     1-0804-003chr12:
68698445-68698445
GAintronicDe novo--Yuen2017 G
MDM1     2-0116-005chr12:
68822353-68822353
CTintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More