or
or
Exact

Results for "MNS1"

Variant Events: 12

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
MNS1     AU2988302chr15:
56749617-56749617
AGintronicDe novo--Yuen2017 G
MNS1     12558.p1chr15:
56735680-56735680
CTexonicDe novononsynonymous SNVNM_018365c.G959Ap.R320Q17.241.655E-5Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Krupp2017 E
Satterstrom2020 E
MNS1     2-1577-003chr15:
56830650-56830650
CTintergenicDe novo--Yuen2017 G
MNS1     Cukier2014:37425chr15:
56723692-56723692
CTexonicUnknownnonsynonymous SNVNM_018365c.G1274Ap.R425H13.110.0015Cukier2014 E
MNS1     1-0079-008chr15:
56741196-56741196
AGintronicDe novo--Yuen2017 G
MNS1     AU4013302chr15:
56777655-56777655
CTintergenicDe novo--Yuen2017 G
MNS1     2-1314-003chr15:
56857328-56857328
AGintergenicDe novo--Yuen2016 G
MNS1     1-0007-003chr15:
56853441-56853441
CTintergenicDe novo--Yuen2017 G
MNS1     AU2988303chr15:
56749617-56749617
AGintronicDe novo--Yuen2017 G
MNS1     2-1353-003chr15:
56820225-56820225
GTintergenicDe novo--Yuen2016 G
Yuen2017 G
MNS1     2-1511-003chr15:
56834815-56834829
CATATATATATATATCATATATATATATintergenicDe novo--Yuen2017 G
MNS1     EGAN00001101223chr15:
56757203-56757203
ACUTR5De novo-4.0E-4Satterstrom2020 E
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More