or
or
Exact

Results for "CNTN5"

Variant Events: 153

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
CNTN5     1-0126-004chr11:
99601758-99601758
ATintronicDe novo--Yuen2017 G
CNTN5     AU1725306chr11:
98098397-98098397
GCintergenicDe novo--Yuen2017 G
CNTN5     AU2140305chr11:
100324010-100324010
TAintergenicDe novo--Yuen2017 G
CNTN5     1-0321-004chr11:
98182770-98182770
CTintergenicDe novo--Yuen2017 G
CNTN5     1-0225-003chr11:
99423558-99423572
CCTCTCTCTCTCTCTCCTCTCTCTCTCTintronicDe novo--Yuen2017 G
CNTN5     AU2756306chr11:
99647698-99647698
TCintronicDe novo--Yuen2017 G
CNTN5     7-0080-003chr11:
98115701-98115701
TCintergenicDe novo--Yuen2017 G
CNTN5     2-1336-003chr11:
98220047-98220047
AGintergenicDe novo--Yuen2017 G
CNTN5     AU3702307chr11:
99377720-99377720
AGintronicDe novo--Yuen2017 G
CNTN5     AU4365302chr11:
97964785-97964791
TAAAAAATintergenicDe novo--Yuen2017 G
CNTN5     AU063005chr11:
97209856-97209856
CTintergenicDe novo--Yuen2017 G
CNTN5     AU4433301chr11:
97417824-97417824
CTintergenicDe novo--Yuen2017 G
CNTN5     7-0255-003chr11:
100356898-100356898
ACintergenicDe novo--Yuen2017 G
CNTN5     2-0300-003chr11:
99766104-99766104
ACintronicDe novo--Yuen2017 G
CNTN5     AU3716301chr11:
98272923-98272923
CGintergenicDe novo--Yuen2017 G
CNTN5     AU3648301chr11:
100328647-100328647
TAintergenicDe novo--Yuen2017 G
CNTN5     AU3716301chr11:
99717907-99717907
TAintronicDe novo--Yuen2017 G
CNTN5     2-0098-003chr11:
100449434-100449434
CTintergenicDe novo--Yuen2017 G
CNTN5     2-1148-004chr11:
97530369-97530369
ATintergenicDe novo--Yuen2017 G
CNTN5     1-0533-003chr11:
100109784-100109784
CTintronicDe novo--Yuen2017 G
CNTN5     5-0017-004chr11:
97982910-97982910
CTintergenicDe novo--Yuen2017 G
CNTN5     AU030703chr11:
100145751-100145751
AGintronicDe novo--Yuen2017 G
CNTN5     7-0135-003chr11:
99535110-99535110
GTintronicDe novo--Yuen2017 G
CNTN5     2-1384-003chr11:
99668324-99668324
TCintronicDe novo--Yuen2017 G
CNTN5     2-1477-003chr11:
97055819-97055819
TCintergenicDe novo--Yuen2016 G
Yuen2017 G
CNTN5     7-0223-003chr11:
96896988-96896988
GAintergenicDe novo--Yuen2017 G
CNTN5     AU4197301chr11:
98143795-98143795
GCintergenicDe novo--Yuen2017 G
CNTN5     2-0310-004chr11:
97904220-97904227
AGAAGACTAintergenicDe novo--Yuen2017 G
CNTN5     AU045514chr11:
100117705-100117705
AGintronicDe novo--Yuen2017 G
CNTN5     2-0273-003chr11:
100032307-100032318
AACTGACTTCACAintronicDe novo--Yuen2017 G
CNTN5     5-0055-003chr11:
96851511-96851511
GTintergenicDe novo--Yuen2017 G
CNTN5     2-1526-003chr11:
99671348-99671348
TAintronicDe novo--Yuen2017 G
CNTN5     1-0640-003chr11:
99921527-99921527
AGintronicDe novo--Yuen2017 G
CNTN5     2-1526-003chr11:
99257615-99257615
TGintronicDe novo--Yuen2017 G
CNTN5     AU005214chr11:
97140641-97140641
TCintergenicDe novo--Yuen2017 G
CNTN5     2-1526-003chr11:
96814276-96814276
TCintergenicDe novo--Yuen2017 G
CNTN5     1-0511-003chr11:
99638025-99638042
CAGAGAGAGAGAGAGAGACAGAGAGAGAGAGAGAintronicDe novo--Yuen2017 G
CNTN5     1-0914-003chr11:
99628930-99628930
TCintronicDe novo--Yuen2017 G
CNTN5     2-0012-004chr11:
98012892-98012892
AGintergenicDe novo--Yuen2017 G
CNTN5     AU4473301chr11:
99055460-99055460
TGintronicDe novo--Yuen2017 G
CNTN5     2-1594-003chr11:
98014856-98014856
GAintergenicDe novo--Yuen2017 G
CNTN5     7-0248-003chr11:
100279209-100279209
CTintergenicDe novo--Yuen2017 G
CNTN5     AU060803chr11:
99367301-99367301
TCintronicDe novo--Yuen2017 G
CNTN5     AU4186302chr11:
99471825-99471825
GAintronicDe novo--Yuen2017 G
CNTN5     5-0030-003chr11:
97121941-97121941
TCintergenicDe novo--Yuen2017 G
CNTN5     AU1355301chr11:
99488888-99488888
CAintronicDe novo--Yuen2017 G
CNTN5     1-0563-004chr11:
98944180-98944180
AGintronicDe novo--Yuen2017 G
CNTN5     Cukier2014:17342chr11:
100168410-100168410
TAexonicUnknownnonsynonymous SNVNM_175566
NM_001243270
NM_001243271
NM_014361
c.T2146A
c.T2368A
c.T2368A
c.T2368A
p.L716I
p.L790I
p.L790I
p.L790I
13.980.0097Cukier2014 E
CNTN5     1-0162-004chr11:
98049321-98049336
ACAGTCCTCTCTATACAintergenicDe novo--Yuen2017 G
CNTN5     1-0162-004chr11:
96998720-96998720
GGATTintergenicDe novo--Yuen2017 G
CNTN5     1-0200-004chr11:
98063798-98063798
GAintergenicDe novo--Yuen2017 G
CNTN5     2-1567-004chr11:
100231928-100231928
GAintergenicDe novo--Yuen2017 G
CNTN5     5-0138-003chr11:
100116013-100116013
CAintronicDe novo--Yuen2017 G
CNTN5     1-0162-004chr11:
99679333-99679333
TAintronicDe novo--Yuen2017 G
CNTN5     2-0068-003chr11:
99051651-99051651
CAintronicDe novo--Yuen2017 G
CNTN5     AU4243302chr11:
98955830-98955830
TCintronicDe novo--Yuen2017 G
CNTN5     5-0073-003chr11:
97998470-97998470
GAintergenicDe novo--Yuen2017 G
CNTN5     5-0131-003chr11:
100457458-100457458
ACintergenicDe novo--Yuen2017 G
CNTN5     AU2410301chr11:
99084133-99084143
ACACATATATGAintronicDe novo--Yuen2017 G
CNTN5     1-0394-003chr11:
99946665-99946665
CGintronicDe novo--Yuen2017 G
CNTN5     2-0068-003chr11:
99814428-99814428
GGAGTTintronicDe novo--Yuen2017 G
CNTN5     1-0186-005chr11:
97902282-97902282
TCintergenicDe novo--Yuen2017 G
CNTN5     1-0820-003chr11:
99771697-99771697
GAintronicDe novo--Yuen2017 G
CNTN5     AU066206chr11:
97827364-97827364
GAintergenicDe novo--Yuen2017 G
CNTN5     AU066206chr11:
97866637-97866637
GAintergenicDe novo--Yuen2017 G
CNTN5     AU066206chr11:
100033978-100033978
GAintronicDe novo--Yuen2017 G
CNTN5     AU2793303chr11:
97965915-97965915
CTintergenicDe novo--Yuen2017 G
CNTN5     1-0479-006chr11:
99744835-99744835
GAintronicDe novo--Yuen2017 G
CNTN5     2-0022-005chr11:
100277839-100277839
GCintergenicDe novo--Yuen2017 G
CNTN5     2-1475-003chr11:
99986774-99986774
CTintronicDe novo--Yuen2017 G
CNTN5     1-0636-003chr11:
99826421-99826421
GCintronicDe novo--Yuen2017 G
CNTN5     AU4426303chr11:
99516920-99516920
CGintronicDe novo--Yuen2017 G
CNTN5     2-0149-004chr11:
97311274-97311274
TCintergenicDe novo--Yuen2017 G
CNTN5     11089.p1chr11:
98248213-98248213
GTintergenicDe novo--Turner2016 G
CNTN5     AU1940304chr11:
99583818-99583818
TCintronicDe novo--Yuen2017 G
CNTN5     13539.p1chr11:
98250616-98250616
CTintergenicDe novo--Turner2016 G
CNTN5     1-0466-003chr11:
97380873-97380873
GCintergenicDe novo--Yuen2017 G
CNTN5     14153.p1 Complex Event; expand row to view variants  De novo--Turner2016 G
Turner2016 G
CNTN5     13023.p1chr11:
98898914-98898914
TCintronicDe novo--Turner2016 G
CNTN5     12793.p1chr11:
98256949-98256949
GAintergenicDe novo--Turner2016 G
CNTN5     1-0253-005chr11:
100443505-100443505
AGintergenicDe novo--Yuen2017 G
CNTN5     2-1362-003chr11:
99013701-99013701
TAintronicDe novo--Yuen2017 G
CNTN5     11572.p1chr11:
99374703-99374703
TCintronicDe novo--Turner2016 G
CNTN5     1-0259-005chr11:
98025433-98025443
GTACGTATGGAGintergenicDe novo--Yuen2017 G
CNTN5     14482.p1chr11:
99093084-99093084
GCintronicDe novo--Turner2016 G
CNTN5     AU4164301chr11:
98933070-98933070
TGintronicDe novo--Yuen2017 G
CNTN5     13543.p1chr11:
99280196-99280196
CTintronicDe novo--Turner2016 G
CNTN5     7-0130-003chr11:
99814428-99814428
GGAGTTintronicDe novo--Yuen2017 G
CNTN5     1-0554-003chr11:
97229035-97229035
TCintergenicDe novo--Yuen2017 G
CNTN5     AU3716302chr11:
98272923-98272923
CGintergenicDe novo--Yuen2017 G
CNTN5     3-0436-000chr11:
96827411-96827425
CCTCTCTCTCTCTCTCCTCTCTCTCTCTintergenicDe novo--Yuen2017 G
CNTN5     1-0191-004chr11:
98932654-98932654
CTintronicDe novo--Yuen2017 G
CNTN5     1-0148-005chr11:
99078802-99078802
AGintronicDe novo--Yuen2017 G
CNTN5     2-0098-003chr11:
100287887-100287887
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
CNTN5     2-1276-003chr11:
98056073-98056073
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
CNTN5     2-1644-003chr11:
98996482-98996482
CGintronicDe novo--Yuen2017 G
CNTN5     2-1272-003chr11:
97752773-97752773
GAintergenicDe novo--Yuen2016 G
CNTN5     7-0242-003chr11:
100472341-100472341
AGintergenicDe novo--Yuen2017 G
CNTN5     AU3768302chr11:
99123619-99123619
GTintronicDe novo--Yuen2017 G
CNTN5     AU2109301chr11:
96941973-96941973
AGintergenicDe novo--Yuen2017 G
CNTN5     2-1295-003chr11:
97783322-97783322
TCintergenicDe novo--Yuen2016 G
Yuen2017 G
CNTN5     2-1189-003chr11:
97150744-97150744
GAintergenicDe novo--Yuen2016 G
Yuen2017 G
CNTN5     7-0008-003chr11:
96900252-96900252
CTintergenicDe novo--Yuen2017 G
CNTN5     AU4235303chr11:
100231187-100231187
CTintergenicDe novo--Yuen2017 G
CNTN5     5-0087-003chr11:
97112177-97112179
TTATTATAintergenicDe novo--Yuen2017 G
CNTN5     AU4013302chr11:
99316676-99316676
GAintronicDe novo--Yuen2017 G
CNTN5     AU4015302chr11:
100424293-100424293
CTintergenicDe novo--Yuen2017 G
CNTN5     1-1000-003chr11:
97643658-97643658
TAintergenicDe novo--Yuen2017 G
CNTN5     2-0295-003chr11:
97052042-97052042
CGintergenicDe novo--Yuen2017 G
CNTN5     1-0552-003chr11:
100153638-100153638
GAintronicDe novo--Yuen2017 G
CNTN5     AU3634301chr11:
97976792-97976792
GTintergenicDe novo--Yuen2017 G
CNTN5     AU2000304chr11:
98207885-98207885
GAintergenicDe novo--Yuen2017 G
CNTN5     2-1297-003chr11:
99439872-99439872
TCintronicDe novo--Yuen2017 G
CNTN5     2-1330-003chr11:
99815228-99815228
TCintronicDe novo--Yuen2016 G
Yuen2017 G
CNTN5     3-0437-000chr11:
99360317-99360317
ACintronicDe novo--Yuen2016 G
CNTN5     AU2437302chr11:
100136664-100136664
GAintronicDe novo--Yuen2017 G
CNTN5     2-1166-003chr11:
100252274-100252274
TCintergenicDe novo--Yuen2016 G
Yuen2017 G
CNTN5     AU2525302chr11:
99071233-99071239
AAATAATAAATintronicDe novo--Yuen2017 G
CNTN5     3-0482-000chr11:
99293521-99293521
AGintronicDe novo--Yuen2017 G
CNTN5     AU3862305chr11:
98261632-98261632
TCintergenicDe novo--Yuen2017 G
CNTN5     1-0382-004chr11:
98257773-98257773
CAintergenicDe novo--Yuen2017 G
CNTN5     AU3905301chr11:
97471431-97471431
ATintergenicDe novo--Yuen2017 G
CNTN5     2-1460-003chr11:
99804708-99804708
AGintronicDe novo--Yuen2017 G
CNTN5     A32chr11:
97345247-97345247
CTintergenicDe novo--Wu2018 G
CNTN5     2-1736-003chr11:
97029326-97029326
GAintergenicDe novo--Yuen2017 G
CNTN5     AU059903chr11:
97857829-97857829
AGintergenicDe novo--Yuen2017 G
CNTN5     2-0127-004chr11:
97214914-97214917
AGATAintergenicDe novo--Yuen2017 G
CNTN5     2-1689-003chr11:
99734266-99734270
CTGTGCTGintronicDe novo--Yuen2017 G
CNTN5     AU3761302chr11:
99684785-99684785
TCintronicDe novo--Yuen2017 G
CNTN5     1-0112-004chr11:
97351138-97351138
CTintergenicDe novo--Yuen2017 G
CNTN5     2-1132-003chr11:
98190904-98190904
TGintergenicDe novo--Yuen2017 G
CNTN5     AU076808chr11:
99615108-99615108
GAintronicDe novo--Yuen2017 G
CNTN5     2-1422-003chr11:
96919886-96919886
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
CNTN5     AU3801301chr11:
97799535-97799535
GAintergenicDe novo--Yuen2017 G
CNTN5     2-1363-003chr11:
97430858-97430858
GAintergenicDe novo--Yuen2017 G
CNTN5     AU4089301chr11:
98061627-98061627
GAintergenicDe novo--Yuen2017 G
CNTN5     2-0310-003chr11:
97547876-97547876
AGintergenicDe novo--Yuen2017 G
CNTN5     2-1066-003chr11:
97530369-97530369
ATintergenicDe novo--Yuen2017 G
CNTN5     7-0247-003chr11:
98995976-98995976
AGintronicDe novo--Yuen2017 G
CNTN5     1-0180-004chr11:
99877749-99877749
TAintronicDe novo--Yuen2017 G
CNTN5     2-1567-003chr11:
99261930-99261930
GTintronicDe novo--Yuen2017 G
CNTN5     AU4168306chr11:
96867179-96867179
GAintergenicDe novo--Yuen2017 G
CNTN5     1-0534-004chr11:
99112051-99112051
TTGintronicDe novo--Yuen2017 G
CNTN5     AU4013303chr11:
97120117-97120117
TCintergenicDe novo--Yuen2017 G
CNTN5     AU3911302chr11:
97999161-97999161
TCintergenicDe novo--Yuen2017 G
CNTN5     AU3190305chr11:
97216851-97216859
ATATTCTATATATTCTATTCTATintergenicDe novo--Yuen2017 G
CNTN5     AU3190305chr11:
99607434-99607434
CTintronicDe novo--Yuen2017 G
CNTN5     2-0244-004chr11:
99051657-99051657
TCintronicDe novo--Yuen2017 G
CNTN5     AU4479301chr11:
100394042-100394042
CTintergenicDe novo--Yuen2017 G
CNTN5     1-0885-003chr11:
99403681-99403681
CTintronicDe novo--Yuen2017 G
CNTN5     1-0826-004chr11:
97065402-97065402
TAintergenicDe novo--Yuen2017 G
CNTN5     2-1715-003chr11:
100056668-100056668
GGTAATCintronicDe novo--Yuen2017 G
CNTN5     2-1297-004chr11:
97523726-97523726
TCintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More