or
or
Exact

Results for "MROH5"

Variant Events: 41

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
MROH5     1-0395-004chr8:
142661407-142661407
TGintergenicDe novo--Yuen2017 G
MROH5     AU1909304chr8:
142613480-142613480
GAintergenicDe novo--Yuen2017 G
MROH5     5-0148-003chr8:
142588876-142588876
TCintergenicDe novo--Yuen2017 G
MROH5     2-1526-004chr8:
142668435-142668435
CCCACCATintergenicDe novo--Yuen2017 G
MROH5     2-1299-003chr8:
142837622-142837622
GTintergenicDe novo--Yuen2017 G
MROH5     Cukier2014:37037chr8:
142500315-142500315
GAexonicUnknownunknown-0.0144Cukier2014 E
MROH5     EGAN00001100985chr8:
142500303-142500303
ACexonicDe novounknown-2.0E-4Satterstrom2020 E
MROH5     AU4219302chr8:
142497941-142497941
CTintronicDe novo--Yuen2017 G
MROH5     7-0223-003chr8:
142853450-142853450
AGintergenicDe novo--Yuen2017 G
MROH5     EGAN00001100993chr8:
142500303-142500303
ACexonicDe novounknown-2.0E-4Satterstrom2020 E
MROH5     1-0338-005chr8:
142837622-142837622
GTintergenicDe novo--Yuen2017 G
MROH5     1-0978-003chr8:
142685265-142685265
ATintergenicDe novo--Yuen2017 G
MROH5     12430.p1chr8:
142480789-142480789
ACexonicMosaic Mat.unknown-4.859E-5Dou2017 E
MROH5     AU065807chr8:
142456070-142456072
CGACGAAAGAintronicDe novo--Yuen2017 G
MROH5     2-0012-003chr8:
142837340-142837340
GAintergenicDe novo--Yuen2017 G
MROH5     2-0012-003chr8:
142525333-142525333
TTCCATCCACACTTCCACCCACCCACintergenicDe novo--Yuen2017 G
MROH5     A1chr8:
142512791-142512791
TCintronicDe novo--Wu2018 G
MROH5     2-0022-003chr8:
142685768-142685768
TCintergenicDe novo--Yuen2017 G
MROH5     1-0373-003chr8:
142553368-142553368
GAintergenicDe novo--Yuen2017 G
MROH5     2-1290-003chr8:
142837622-142837622
GTintergenicDe novo--Yuen2017 G
MROH5     1-0640-003chr8:
142540368-142540368
AGintergenicDe novo--Yuen2017 G
MROH5     3-0482-000chr8:
142577946-142577946
CTintergenicDe novo--Yuen2017 G
MROH5     AU076705chr8:
142661171-142661171
CAintergenicDe novo--Yuen2017 G
MROH5     5-0030-003chr8:
142525338-142525338
CAintergenicDe novo--Yuen2017 G
MROH5     1-0395-003chr8:
142661407-142661407
TGintergenicDe novo--Yuen2017 G
MROH5     2-0012-004chr8:
142837567-142837567
GGTGGTGATGGTGATGATGATGGTAATGGTGGTGATGAintergenicDe novo--Yuen2017 G
MROH5     3-0448-000chr8:
142602885-142602885
GAintergenicDe novo--Yuen2016 G
Yuen2017 G
MROH5     12622.p1chr8:
142458137-142458137
CTexonicDe novounknown-9.636E-6Iossifov2014 E
Kosmicki2017 E
Satterstrom2020 E
Wilfert2021 G
MROH5     AU2950301chr8:
142688511-142688511
CTintergenicDe novo--Yuen2017 G
MROH5     AU3900302chr8:
142572513-142572513
TAintergenicDe novo--Yuen2017 G
MROH5     1-0225-003chr8:
142535070-142535070
CTintergenicDe novo--Yuen2017 G
MROH5     1-0329-004chr8:
142525321-142525321
CCACATTCATintergenicDe novo--Yuen2017 G
MROH5     2-1715-003chr8:
142525455-142525455
CCAintergenicDe novo--Yuen2017 G
MROH5     2-1252-003chr8:
142514899-142514899
GAintronicDe novo--Yuen2017 G
MROH5     1-0772-003chr8:
142593031-142593031
CTintergenicDe novo--Yuen2017 G
MROH5     13393.p1chr8:
142591935-142591935
GAintergenicDe novo--Turner2016 G
MROH5     2-1356-003chr8:
142640938-142640938
TCintergenicDe novo--Yuen2017 G
MROH5     1-0065-004chr8:
142559670-142559670
CTintergenicDe novo--Yuen2017 G
MROH5     AU2022302chr8:
142568079-142568079
GCintergenicDe novo--Yuen2017 G
MROH5     2-1455-003chr8:
142455329-142455329
CTintronicDe novo--Yuen2016 G
Yuen2017 G
MROH5     1-0524-003chr8:
142494221-142494221
ATintronicDe novo--Yuen2016 G
Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More