or
or
Exact

Results for "ITGA9"

Variant Events: 18

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
ITGA9     1-0162-004chr3:
37603824-37603824
CGintronicDe novo--Yuen2017 G
ITGA9     7-0032-003chr3:
37629899-37629899
GAintronicDe novo--Yuen2017 G
ITGA9     1-0051-005chr3:
37704260-37704260
ATintronicDe novo--Yuen2017 G
ITGA9     08C76644chr3:
37791961-37791961
CTexonicDe novosynonymous SNVNM_002207c.C2442Tp.N814N-8.238E-6Satterstrom2020 E
ITGA9     1-0138-004chr3:
37687592-37687592
AGintronicDe novo--Yuen2017 G
ITGA9     AU005213chr3:
37510775-37510775
CAintronicDe novo--Yuen2017 G
ITGA9     AU0146302chr3:
37701952-37701952
CAintronicDe novo--Yuen2017 G
ITGA9     7-0183-003chr3:
37533102-37533102
TCintronicDe novo--Yuen2017 G
ITGA9     1-0079-003chr3:
37750146-37750146
AACAGCAAGGAATTATCCAACintronicDe novo--Yuen2017 G
ITGA9     1-0305-004chr3:
37507308-37507308
CGintronicDe novo--Yuen2017 G
ITGA9     AU005214chr3:
37510775-37510775
CAintronicDe novo--Yuen2017 G
ITGA9     AU2863303chr3:
37791215-37791218
CAAACAAintronicDe novo--Yuen2017 G
ITGA9     AU3866301chr3:
37723187-37723190
CAAACAAintronicDe novo--Yuen2017 G
ITGA9     Cukier2014:17342chr3:
37785454-37785454
GAexonicUnknownnonsynonymous SNVNM_002207c.G2362Ap.V788M14.540.0027Cukier2014 E
ITGA9     2-1297-004chr3:
37633389-37633389
GCintronicDe novo--Yuen2017 G
ITGA9     AU3900301chr3:
37606157-37606157
AGintronicDe novo--Yuen2017 G
ITGA9     2-0090-003chr3:
37779034-37779034
GCintronicDe novo--Yuen2017 G
ITGA9     2-0270-003chr3:
37609547-37609547
TGintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More