
Results for "GUCA1B"

Variant Events: 3

Gene symbol on which the variant is located
Subject Identifier from the original study
Genomic location of the reference allele
Reference allele
Alternate allele
Variant functional categories
Variant validation performed by an orthogonal method and reported
Reported inheritance status
Variant effect on transcript per Annovar
Transcript used for the cDNA/Protein mutation
cDNA variant notation
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Source(s) where variants from this event are reported
GUCA1B     Cukier2014:7936chr6:
CAexonicUnknownnonsynonymous SNVNM_002098c.G465Tp.E155D11.820.0087Cukier2014 E
GUCA1B     1-0508-003chr6:
GUCA1B     2-0143-004chr6:
AATCTATCTATCTATCTATCintronicDe novo--Yuen2017 G
Source Variant Information

, -


Paper alias:

No records found.
Paper Information
Variant source
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView