or
or
Exact

Results for "GLIS3"

Variant Events: 63

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
GLIS3     AU4176302chr9:
4331317-4331317
CTintergenicDe novo--Yuen2017 G
GLIS3     1-0441-003chr9:
4066024-4066039
ATGACCCAAAGAATATAintronicDe novo--Yuen2016 G
GLIS3     1-0375-003chr9:
3971167-3971167
AGintronicDe novo--Yuen2016 G
GLIS3     2-0006-003chr9:
4460566-4460566
CTintergenicDe novo--Yuen2017 G
GLIS3     1-0286-004chr9:
4330658-4330659
GAGintergenicDe novo--Yuen2017 G
GLIS3     2-0244-003chr9:
3966727-3966727
GAintronicDe novo--Yuen2017 G
GLIS3     2-1605-003chr9:
3769589-3769589
GAintergenicDe novo--Yuen2017 G
GLIS3     1-0144-005chr9:
4270030-4270030
TCintronicDe novo--Yuen2017 G
GLIS3     5-0140-003chr9:
3871778-3871778
CGintronicDe novo--Yuen2017 G
GLIS3     2-1089-004chr9:
3923317-3923317
AGintronicDe novo--Yuen2017 G
GLIS3     5-0140-003chr9:
4020844-4020844
GAintronicDe novo--Yuen2017 G
GLIS3     AU4159301chr9:
4008240-4008240
CAintronicDe novo--Yuen2017 G
GLIS3     2-1089-004chr9:
3753938-3753938
TGintergenicDe novo--Yuen2017 G
GLIS3     AU4433301chr9:
3693232-3693232
GTintergenicDe novo--Yuen2017 G
GLIS3     1-0513-003chr9:
3983312-3983312
CGintronicDe novo--Yuen2016 G
Yuen2017 G
GLIS3     1-0597-003chr9:
3824535-3824539
TAAAATUTR3De novo--Yuen2017 G
GLIS3     AU4188302chr9:
4007583-4007583
AGintronicDe novo--Yuen2017 G
GLIS3     Cukier2014:37425chr9:
4118634-4118634
GCexonicUnknownnonsynonymous SNVNM_152629
NM_001042413
c.C379G
c.C844G
p.P127A
p.P282A
12.590.002Cukier2014 E
GLIS3     2-0135-003chr9:
4176816-4176816
GGTTTCintronicDe novo--Yuen2017 G
GLIS3     2-1734-003chr9:
4086374-4086374
GAintronicDe novo--Yuen2017 G
GLIS3     AU027506chr9:
4393009-4393009
TAintergenicDe novo--Yuen2017 G
GLIS3     1-0627-007chr9:
3906578-3906578
CTintronicDe novo--Yuen2017 G
GLIS3     AU027506chr9:
4405619-4405619
GAintergenicDe novo--Yuen2017 G
GLIS3     AU3730301chr9:
4444940-4444940
GAintergenicDe novo--Yuen2017 G
GLIS3     A11chr9:
3940896-3940896
CTintronicDe novo--Wu2018 G
GLIS3     1-0218-003chr9:
3746240-3746240
AGintergenicDe novo--Yuen2017 G
GLIS3     7-0161-003chr9:
3947062-3947062
GCintronicDe novo--Yuen2017 G
GLIS3     AU3343301chr9:
4353874-4353874
ATintergenicDe novo--Yuen2017 G
GLIS3     1-0804-003chr9:
4452676-4452676
AGintergenicDe novo--Yuen2017 G
GLIS3     7-0249-003chr9:
4386288-4386288
GTintergenicDe novo--Yuen2017 G
GLIS3     1-0627-004chr9:
4037254-4037254
CTintronicDe novo--Yuen2017 G
GLIS3     AU4239301chr9:
3764192-3764192
CTintergenicDe novo--Yuen2017 G
GLIS3     AU1987302chr9:
4330036-4330036
CTintergenicDe novo--Yuen2017 G
GLIS3     1-0119-004chr9:
3876696-3876696
GGAintronicDe novo--Yuen2017 G
GLIS3     1-0193-003chr9:
4123720-4123720
ATintronicDe novo--Yuen2017 G
GLIS3     12377.p1chr9:
4148382-4148382
TCintronicDe novo--Werling2018 G
GLIS3     2-1366-003chr9:
4237129-4237129
CCAAAAAAAAAAAAAATAAAATintronicDe novo--Yuen2017 G
GLIS3     2-0198-005chr9:
4182096-4182096
CTintronicDe novo--Yuen2017 G
GLIS3     1-0513-003chr9:
3984876-3984876
GAintronicDe novo--Yuen2017 G
GLIS3     12011.p1chr9:
3734604-3734604
TCintergenicDe novo--Turner2016 G
GLIS3     2-1127-003chr9:
4385572-4385572
GAintergenicDe novo--Yuen2016 G
Yuen2017 G
GLIS3     AGG0016chr9:
3937073-3937073
AGexonicDe novosynonymous SNVNM_152629
NM_001042413
c.T1362C
c.T1827C
p.S454S
p.S609S
--Satterstrom2020 E
GLIS3     AU3712301chr9:
4417489-4417489
GCintergenicDe novo--Yuen2017 G
GLIS3     2-1361-003chr9:
3921831-3921831
TCintronicDe novo--Yuen2016 G
GLIS3     AU3724301chr9:
3809769-3809769
ACintergenicDe novo--Yuen2017 G
GLIS3     5-0026-003chr9:
3876696-3876696
GGAintronicDe novo--Yuen2017 G
GLIS3     AU079104chr9:
4347263-4347263
TCintergenicDe novo--Yuen2017 G
GLIS3     AU079104chr9:
4352246-4352246
GAintergenicDe novo--Yuen2017 G
GLIS3     AU3912303chr9:
3957999-3957999
CTintronicDe novo--Yuen2017 G
GLIS3     AU3912303chr9:
4224411-4224411
GAintronicDe novo--Yuen2017 G
GLIS3     1-0073-003chr9:
4370100-4370100
GAintergenicDe novo--Yuen2017 G
GLIS3     2-1066-003chr9:
4449122-4449122
TCintergenicDe novo--Yuen2017 G
GLIS3     1-0452-003chr9:
3946003-3946003
CTintronicDe novo--Yuen2016 G
Yuen2017 G
GLIS3     2-0198-004chr9:
4182096-4182096
CTintronicDe novo--Yuen2017 G
GLIS3     AU2000305chr9:
3869395-3869395
CTintronicDe novo--Yuen2017 G
GLIS3     AU4191302chr9:
4264038-4264038
GCintronicDe novo--Yuen2017 G
GLIS3     1506001chr9:
3879494-3879494
GAexonicDe novostopgainNM_152629
NM_001042413
c.C1765T
c.C2230T
p.Q589X
p.Q744X
46.0-Satterstrom2020 E
GLIS3     1-0632-003chr9:
3847215-3847215
AAAAAAAAATAAAATTAAATAAATACATAAATintronicDe novo--Yuen2017 G
GLIS3     1-0541-004chr9:
4264010-4264010
CGintronicDe novo--Yuen2017 G
GLIS3     AU3586303chr9:
4308685-4308685
CTintergenicDe novo--Yuen2017 G
GLIS3     1-0433-003chr9:
3708743-3708743
TCintergenicDe novo--Yuen2017 G
GLIS3     2-1258-003chr9:
4009569-4009571
AGGAintronicDe novo--Yuen2017 G
GLIS3     1701001chr9:
3828277-3828277
CGexonicDe novononsynonymous SNVNM_152629
NM_001042413
c.G2323C
c.G2788C
p.G775R
p.G930R
20.4-Satterstrom2020 E
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More