or
or
Exact

Results for "COL22A1"

Variant Events: 75

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
COL22A1     2-0135-004chr8:
140476712-140476712
GTintergenicDe novo--Yuen2017 G
COL22A1     AU3727302chr8:
140387996-140387996
GAintergenicDe novo--Yuen2017 G
COL22A1     1-0567-004chr8:
140491239-140491239
CTintergenicDe novo--Yuen2017 G
COL22A1     AU063005chr8:
139890908-139890908
ATintronicDe novo--Yuen2017 G
COL22A1     TAS_F0203Ychr8:
139675969-139675969
TGexonicDe novosynonymous SNVNM_152888c.A3165Cp.P1055P--Satterstrom2020 E
COL22A1     2-1174-005Bchr8:
140224599-140224599
ACintergenicDe novo--Yuen2017 G
COL22A1     1-0007-003chr8:
140445407-140445407
ACintergenicDe novo--Yuen2017 G
COL22A1     1-0272-003chr8:
139673330-139673330
ACintronicDe novo--Yuen2017 G
COL22A1     1-0482-003chr8:
140212355-140212355
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
COL22A1     AU031403chr8:
139935224-139935224
GAintergenicDe novo--Yuen2017 G
COL22A1     2-1510-003chr8:
140298982-140298982
GAintergenicDe novo--Yuen2017 G
COL22A1     AU3634301chr8:
139659993-139659999
AACATCAAAintronicDe novo--Yuen2017 G
COL22A1     1-0196-005chr8:
139942638-139942638
AGintergenicDe novo--Yuen2017 G
COL22A1     1-0564-003chr8:
140596933-140596933
AGintergenicDe novo--Yuen2017 G
COL22A1     AU066404chr8:
139867957-139867957
TAintronicDe novo--Yuen2017 G
COL22A1     2-0240-004chr8:
140240605-140240605
CTintergenicDe novo--Yuen2017 G
COL22A1     2-1737-003chr8:
140546175-140546175
AGintergenicDe novo--Yuen2017 G
COL22A1     AU056803chr8:
139968717-139968717
GAintergenicDe novo--Yuen2017 G
COL22A1     5-0054-003chr8:
140523164-140523164
CTintergenicDe novo--Yuen2017 G
COL22A1     2-0270-004chr8:
140470414-140470414
GTintergenicDe novo--Yuen2017 G
COL22A1     AU3862305chr8:
140066284-140066284
GAintergenicDe novo--Yuen2017 G
COL22A1     11513.p1chr8:
139791749-139791749
CTintronicDe novo--Iossifov2014 E
Kosmicki2017 E
COL22A1     AU2433303chr8:
139804059-139804059
CAintronicDe novo--Yuen2017 G
COL22A1     1-0339-003chr8:
139818516-139818516
AATGGTGTAGGTAATGGTGTGTGGTGGTGTATGTGTGTintronicDe novo--Yuen2017 G
COL22A1     1-0965-003chr8:
140491676-140491676
TGintergenicDe novo--Yuen2017 G
COL22A1     A4chr8:
139639197-139639197
AGintronicDe novo--Wu2018 G
COL22A1     AU4173301chr8:
140422777-140422777
ATintergenicDe novo--Yuen2017 G
COL22A1     1-0706-003chr8:
140577739-140577739
GAintergenicDe novo--Yuen2017 G
COL22A1     2-0127-004chr8:
140054558-140054558
ATintergenicDe novo--Yuen2017 G
COL22A1     AU3777301chr8:
140516785-140516785
CTintergenicDe novo--Yuen2017 G
COL22A1     AU4359301chr8:
140404710-140404710
CTintergenicDe novo--Yuen2017 G
COL22A1     2-1280-003 Complex Event; expand row to view variants  De novo--Yuen2016 G
Yuen2017 G
COL22A1     Cukier2014:7623chr8:
139815174-139815174
CGexonicUnknownnonsynonymous SNVNM_152888c.G1498Cp.D500H15.837.0E-4Cukier2014 E
COL22A1     1-0271-003chr8:
140019455-140019455
CGintergenicDe novo--Yuen2017 G
COL22A1     2-1094-005chr8:
140158352-140158352
GAintergenicDe novo--Yuen2017 G
COL22A1     1-0413-003chr8:
140128713-140128713
GAintergenicDe novo--Yuen2017 G
COL22A1     2-1341-004chr8:
139818535-139818535
GGTGTTintronicDe novo--Yuen2017 G
COL22A1     1-0382-003chr8:
140599034-140599034
CGintergenicDe novo--Yuen2017 G
COL22A1     1-0382-003chr8:
140448698-140448698
GAintergenicDe novo--Yuen2017 G
COL22A1     1-0054-004chr8:
139992872-139992872
GCintergenicDe novo--Yuen2017 G
COL22A1     1-0257-003chr8:
140615151-140615151
GAintergenicDe novo--Yuen2017 G
COL22A1     1-0460-003chr8:
140395060-140395060
GCintergenicDe novo--Yuen2017 G
COL22A1     1-0054-004chr8:
139986753-139986753
GCintergenicDe novo--Yuen2017 G
COL22A1     1-0447-003chr8:
140525362-140525362
TCintergenicDe novo--Yuen2017 G
COL22A1     1-0052-003chr8:
139625722-139625722
CTintronicDe novo--Yuen2017 G
COL22A1     2-0503-004chr8:
140196079-140196079
TCintergenicDe novo--Yuen2017 G
COL22A1     2-0503-004chr8:
139831518-139831518
TCintronicDe novo--Yuen2017 G
COL22A1     AU3912303chr8:
140020133-140020133
GTintergenicDe novo--Yuen2017 G
COL22A1     2-1382-003chr8:
140149883-140149883
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
COL22A1     1-0277-003chr8:
140591085-140591085
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
COL22A1     1-0294-003chr8:
139828300-139828300
AGintronicDe novo--Yuen2016 G
Yuen2017 G
COL22A1     5-0105-003chr8:
139679615-139679615
GAintronicDe novo--Yuen2017 G
COL22A1     2-0149-004chr8:
139949681-139949681
GAintergenicDe novo--Yuen2017 G
COL22A1     1-0558-003chr8:
139827155-139827155
CGintronicDe novo--Yuen2017 G
COL22A1     2-1416-004chr8:
140224599-140224599
ACintergenicDe novo--Yuen2017 G
COL22A1     1-0514-003chr8:
140590545-140590545
TCintergenicDe novo--Yuen2016 G
Yuen2017 G
COL22A1     1-0354-003chr8:
139999811-139999821
TCACAATACTCTintergenicDe novo--Yuen2017 G
COL22A1     AU1542301chr8:
140103461-140103461
CGintergenicDe novo--Yuen2017 G
COL22A1     AU050910chr8:
139981740-139981740
TCintergenicDe novo--Yuen2017 G
COL22A1     1-0632-003chr8:
140224599-140224599
ACintergenicDe novo--Yuen2017 G
COL22A1     7-0219-003chr8:
140174517-140174517
TGintergenicDe novo--Yuen2017 G
COL22A1     AU4378301chr8:
139941181-139941181
CTintergenicDe novo--Yuen2017 G
COL22A1     2-1143-003chr8:
140242707-140242707
GAintergenicDe novo--Yuen2017 G
COL22A1     AU1725302chr8:
140490621-140490621
GAintergenicDe novo--Yuen2017 G
COL22A1     2-0503-003chr8:
140196079-140196079
TCintergenicDe novo--Yuen2017 G
COL22A1     2-0503-003chr8:
139831518-139831518
TCintronicDe novo--Yuen2017 G
COL22A1     1-0225-003chr8:
140580680-140580680
GAintergenicDe novo--Yuen2017 G
COL22A1     1-0715-003chr8:
140627520-140627520
GAintergenicDe novo--Yuen2017 G
COL22A1     1-0401-003chr8:
140609262-140609262
TTTGintergenicDe novo--Yuen2017 G
COL22A1     2-1105-003 Complex Event; expand row to view variants  De novo--Yuen2016 G
Yuen2017 G
COL22A1     AU031404chr8:
139944689-139944689
ACintergenicDe novo--Yuen2017 G
COL22A1     AU056204chr8:
140614183-140614183
CTintergenicDe novo--Yuen2017 G
COL22A1     2-1114-003chr8:
139997723-139997723
AGintergenicDe novo--Yuen2017 G
COL22A1     2-1154-003chr8:
139603867-139603867
CAintronicDe novo--Yuen2016 G
Yuen2017 G
COL22A1     AU066104chr8:
139715492-139715492
GAintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More