or
or
Exact

Results for "LDLRAD3"

Variant Events: 19

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
LDLRAD3     5-0017-004chr11:
36021720-36021720
AGintronicDe novo--Yuen2017 G
LDLRAD3     2-1620-003chr11:
36279698-36279698
GAintergenicDe novo--Yuen2017 G
LDLRAD3     5-0065-003chr11:
36153478-36153478
GAintronicDe novo--Yuen2017 G
LDLRAD3     2-1518-003chr11:
36203351-36203351
GAintronicDe novo--Yuen2017 G
LDLRAD3     AU4239301chr11:
36130972-36130972
GCintronicDe novo--Yuen2017 G
LDLRAD3     1-0435-003chr11:
36061020-36061020
TAintronicDe novo--Yuen2017 G
LDLRAD3     7-0095-004chr11:
36088089-36088089
ATintronicDe novo--Yuen2017 G
LDLRAD3     2-0273-003chr11:
36103322-36103322
ACexonicDe novononsynonymous SNVNM_001304263
NM_174902
c.A166C
c.A313C
p.N56H
p.N105H
25.6-Yuen2017 G
LDLRAD3     AU3777302chr11:
36024686-36024686
AGintronicDe novo--Yuen2017 G
LDLRAD3     Cukier2014:7797chr11:
36057670-36057670
GAexonicUnknownnonsynonymous SNVNM_174902c.G64Ap.G22R24.92.0E-4Cukier2014 E
LDLRAD3     1-0668-003chr11:
35978374-35978374
CTintronicDe novo--Yuen2017 G
LDLRAD3     2-1362-003chr11:
36119789-36119789
GAintronicDe novo--Yuen2017 G
LDLRAD3     AU012804chr11:
36070313-36070313
CTintronicDe novo--Yuen2017 G
LDLRAD3     1-0138-003chr11:
36076592-36076592
CCATAGAGGGATAGTTGGATGAintronicDe novo--Yuen2017 G
LDLRAD3     2-1442-003chr11:
36081444-36081444
TGintronicDe novo--Yuen2016 G
Yuen2017 G
LDLRAD3     AU2569301chr11:
35978125-35978125
TGintronicDe novo--Yuen2017 G
LDLRAD3     5-0116-003chr11:
36190686-36190692
CCTTCTTCCTTintronicDe novo--Yuen2017 G
LDLRAD3     5-0026-003chr11:
36010733-36010735
GGTGintronicDe novo--Yuen2017 G
LDLRAD3     2-0319-003chr11:
35983976-35983976
TCintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More