or
or
Exact

Results for "CIT"

Variant Events: 22

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
CIT     7-0183-003chr12:
120423871-120423871
ATintergenicDe novo--Yuen2017 G
CIT     AU4173301chr12:
120253174-120253174
TCintronicDe novo--Yuen2017 G
CIT     11117.p1chr12:
120138518-120138518
AGintronicDe novo--Iossifov2014 E
Kosmicki2017 E
Satterstrom2020 E
Wilfert2021 G
CIT     12087.p1chr12:
120156179-120156179
AGexonicDe novononsynonymous SNVNM_007174
NM_001206999
c.T3913C
c.T4039C
p.S1305P
p.S1347P
16.628.291E-6Ji2016 E
Krumm2015 E
Satterstrom2020 E
CIT     Codina-Sola2015:ASD_34chr12:
120190054-120190054
TTGAsplicingUnknownsplicing-0.0346Codina-Sola2015 E
CIT     SSC03133chr12:
120138518-120138518
AGintronicDe novo--Lim2017 E
CIT     2-1342-003chr12:
120218141-120218141
GAintronicDe novo--Yuen2017 G
CIT     1-0325-003chr12:
120201230-120201230
ATintronicDe novo--Yuen2017 G
CIT     2-0318-004chr12:
120273959-120273994
TGCATGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGTintronicDe novo--Yuen2017 G
CIT     SSC06202chr12:
120172026-120172026
TCexonicDe novononsynonymous SNVNM_007174
NM_001206999
c.A3167G
c.A3293G
p.Q1056R
p.Q1098R
13.04-Lim2017 E
CIT     AU3915301chr12:
120391237-120391237
GAintergenicDe novo--Yuen2017 G
CIT     SSC03844chr12:
120156179-120156179
AGexonicDe novononsynonymous SNVNM_007174
NM_001206999
c.T3913C
c.T4039C
p.S1305P
p.S1347P
16.628.291E-6Lim2017 E
CIT     F7938-1chr12:
120295305-120295308
CATGCintronicDe novo--Satterstrom2020 E
CIT     iHART3201chr12:
120271891-120271891
GAexonicPaternalstopgainNM_001206999
NM_007174
c.C658T
c.C658T
p.R220X
p.R220X
37.03.384E-5Ruzzo2019 G
CIT     AU3051303chr12:
120373975-120373975
AGintergenicDe novo--Yuen2017 G
CIT     iHART3202chr12:
120271891-120271891
GAexonicPaternalstopgainNM_001206999
NM_007174
c.C658T
c.C658T
p.R220X
p.R220X
37.03.384E-5Ruzzo2019 G
CIT     G01-GEA-186-HIchr12:
120168331-120168331
TCexonicDe novononsynonymous SNVNM_007174
NM_001206999
c.A3329G
c.A3455G
p.Q1110R
p.Q1152R
12.32-Lim2017 E
Satterstrom2020 E
CIT     11940.p1chr12:
120156083-120156083
AGexonicDe novononsynonymous SNVNM_007174
NM_001206999
c.T4009C
c.T4135C
p.S1337P
p.S1379P
19.22-Satterstrom2020 E
CIT     EGAN00001101419chr12:
120137659-120137659
CTintronicDe novo--Satterstrom2020 E
CIT     Cukier2014:7637chr12:
120220431-120220431
CTexonicUnknownnonsynonymous SNVNM_001206999
NM_007174
c.G1556A
c.G1556A
p.R519Q
p.R519Q
33.08.244E-6Cukier2014 E
CIT     5-0084-003chr12:
120224691-120224691
CTintronicDe novo--Yuen2017 G
CIT     12840.p1chr12:
120172026-120172026
TCexonicDe novononsynonymous SNVNM_007174
NM_001206999
c.A3167G
c.A3293G
p.Q1056R
p.Q1098R
13.04-Iossifov2012 E
Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Krupp2017 E
Satterstrom2020 E
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More