
Results for "EP400"

Variant Events: 41

Gene symbol on which the variant is located
Subject Identifier from the original study
Genomic location of the reference allele
Reference allele
Alternate allele
Variant functional categories
Variant validation performed by an orthogonal method and reported
Reported inheritance status
Variant effect on transcript per Annovar
Transcript used for the cDNA/Protein mutation
cDNA variant notation
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Source(s) where variants from this event are reported
EP400     SP0029297chr12:
GCexonicDe novononsynonymous SNVNM_015409c.G6885Cp.E2295D10.91-Fu2022 E
Trost2022 G
Zhou2022 GE
EP400     SP0084089chr12:
CTexonicDe novononsynonymous SNVNM_015409c.C5437Tp.R1813W8.4622.0E-4Trost2022 G
EP400     SP0006750chr12:
TGexonicDe novononsynonymous SNVNM_015409c.T980Gp.V327G8.074-Fu2022 E
Zhou2022 GE
EP400     SSC09724chr12:
GAexonicDe novosynonymous SNVNM_015409c.G5493Ap.E1831E-1.666E-5Trost2022 G
EP400     146-09-111131chr12:
GAexonicDe novosynonymous SNVNM_015409c.G381Ap.L127L--Fu2022 E
EP400     SP0103857chr12:
CTexonicDe novosynonymous SNVNM_015409c.C6879Tp.R2293R--Fu2022 E
Trost2022 G
Zhou2022 GE
EP400     5-0022-003chr12:
GAintronicDe novo--Trost2022 G
EP400     SSC07901chr12:
ACexonicDe novononsynonymous SNVNM_015409c.A5453Cp.Y1818S8.482-Fu2022 E
EP400     SP0086715chr12:
AGexonicDe novononsynonymous SNVNM_015409c.A3650Gp.N1217S14.86-Fu2022 E
Trost2022 G
Zhou2022 GE
EP400     4-0019-003chr12:
TGintronicDe novo--Trost2022 G
EP400     SP0050119chr12:
GGGGCCCCCCexonicDe novoframeshift insertionNM_015409c.88_89insGGCCCCCCp.A30fs--Fu2022 E
EP400     1-0745-003chr12:
CTintronicDe novo--Trost2022 G
Yuen2017 G
EP400     MSSNG00397-003chr12:
CTexonicDe novostopgainNM_015409c.C7453Tp.R2485X49.0-Trost2022 G
Zhou2022 GE
EP400     MSSNG00026-003chr12:
AGexonicDe novononsynonymous SNVNM_015409c.A3889Gp.K1297E9.054-Trost2022 G
Zhou2022 GE
EP400     13065.p1chr12:
CTexonicnonsynonymous SNVNM_015409c.C8411Tp.P2804L14.858.411E-6Zhou2022 GE
EP400     MSSNG00204-003chr12:
GAexonicDe novosynonymous SNVNM_015409c.G8409Ap.A2803A-2.0E-4Trost2022 G
Zhou2022 GE
EP400     11537.p1chr12:
AAGCAGGTGCTGCAGGGGCCexonicnonframeshift insertionNM_015409c.839_840insGCAGGTGCTGCAGGGGCCp.Q280delinsQQVLQGP--Zhou2022 GE
EP400     SP0143256chr12:
ACintronicDe novo--Trost2022 G
EP400     ASC_CA_161_Achr12:
CTexonicDe novosynonymous SNVNM_015409c.C669Tp.P223P--Fu2022 E
EP400     SP0150012chr12:
CTintronicDe novo--Fu2022 E
EP400     MSSNG00226-003chr12:
GAexonicDe novosynonymous SNVNM_015409c.G3630Ap.L1210L--Trost2022 G
Zhou2022 GE
EP400     2-1629-003chr12:
CTintronicDe novo--Trost2022 G
EP400     MSSNG00203-003chr12:
CTintronicDe novo--Trost2022 G
Zhou2022 GE
EP400     AU2308301chr12:
CTintronicDe novo--Trost2022 G
EP400     1-0806-003chr12:
GAACAACAGAACAintronicDe novo--Yuen2017 G
EP400     1-0976-003chr12:
CTexonicDe novononsynonymous SNVNM_015409c.C428Tp.P143L8.334-Yuen2017 G
Zhou2022 GE
EP400     AU075308chr12:
GAexonicUnknownnonsynonymous SNVNM_015409c.G4945Ap.A1649T12.90.003Chahrour2012 E
EP400     12548.p1chr12:
GAexonicDe novononsynonymous SNVNM_015409c.G5923Ap.G1975R14.27-Iossifov2012 E
Iossifov2014 E
Ji2016 E
Kosmicki2017 E
EP400     DEASD_0364_001chr12:
AATCCCexonicDe novoframeshift insertionNM_015409c.1837_1838insTCCCp.I613fs--DeRubeis2014 E
Fu2022 E
Kosmicki2017 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
EP400     08C79227chr12:
CTexonicDe novosynonymous SNVNM_015409c.C3771Tp.V1257V--DeRubeis2014 E
Fu2022 E
Kosmicki2017 E
Lim2017 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
EP400     AU075308chr12:
CTexonicUnknownnonsynonymous SNVNM_015409c.C6097Tp.P2033S11.740.0011Chahrour2012 E
EP400     AU1940304chr12:
TCexonicDe novononsynonymous SNVNM_015409c.T1117Cp.Y373H1.1859.0E-4Yuen2017 G
Zhou2022 GE
EP400     2-1140-003chr12:
GGAAintronicDe novo--Yuen2017 G
EP400     11226.p1chr12:
CTexonicMosaicnonsynonymous SNVNM_015409c.C5818Tp.R1940C12.898.239E-6Krupp2017 E
EP400     2-1508-004chr12:
ACintronicDe novo--Trost2022 G
Yuen2017 G
EP400     13907.p1chr12:
GAexonicMosaic, De novosynonymous SNVNM_015409c.G5493Ap.E1831E-1.666E-5Dou2017 E
Iossifov2014 E
Kosmicki2017 E
Satterstrom2020 E
Zhou2022 GE
EP400     14278.p1chr12:
CTCexonicDe novoframeshift deletionNM_015409c.7053delTp.P2351fs--Ji2016 E
EP400     11241.p1chr12:
GTUTR3De novo--Krumm2015 E
EP400     AU1987304chr12:
CGintronicDe novo--Yuen2017 G
EP400     1-0285-003chr12:
TCintronicDe novo--Trost2022 G
Yuen2017 G
EP400     AU1894304chr12:
GTintronicDe novo--Trost2022 G
Yuen2017 G
Source Variant Information

, -


Paper alias:

No records found.
Paper Information
Variant source
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView