
Results for "ARHGAP21"

Variant Events: 24

Gene symbol on which the variant is located
Subject Identifier from the original study
Genomic location of the reference allele
Reference allele
Alternate allele
Variant functional categories
Variant validation performed by an orthogonal method and reported
Reported inheritance status
Variant effect on transcript per Annovar
Transcript used for the cDNA/Protein mutation
cDNA variant notation
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Source(s) where variants from this event are reported
ARHGAP21     A31chr10:
AACAAAAexonicDe novoframeshift insertionNM_020824c.3829_3830insTTTTGp.L1277fs--Wu2018 G
ARHGAP21     AU4028302chr10:
CTintronicDe novo--Yuen2017 G
ARHGAP21     A31chr10:
CCTTATTTTTTCexonicDe novoframeshift deletionNM_020824c.3867_3876delp.E1289fs--Wu2018 G
ARHGAP21     1-0488-003chr10:
CTintronicDe novo--Yuen2017 G
ARHGAP21     AU3610302chr10:
AGintergenicDe novo--Yuen2017 G
ARHGAP21     7-0100-003chr10:
AACTATCAAAGintronicDe novo--Yuen2017 G
ARHGAP21     12645_p1chr10:
AGexonicDe novononsynonymous SNVNM_020824c.T2444Cp.I815T13.0-Fu2022 E
ARHGAP21     AU027506chr10:
AGintergenicDe novo--Yuen2017 G
ARHGAP21     AU2293302chr10:
GTintergenicDe novo--Yuen2017 G
ARHGAP21     5-0095-003chr10:
CTintronicDe novo--Yuen2017 G
ARHGAP21     Li2017:20559chr10:
GAexonicUnknownnonsynonymous SNVNM_020824c.C2375Tp.S792L23.19.068E-5Li2017 T
ARHGAP21     AU018010chr10:
CGintronicDe novo--Yuen2017 G
ARHGAP21     SP0049129chr10:
TCexonicDe novononsynonymous SNVNM_020824c.A304Gp.I102V23.8-Feliciano2019 E
Fu2022 E
ARHGAP21     SP0136227chr10:
CCTTCexonicDe novononframeshift deletionNM_020824c.326_328delp.109_110del--Fu2022 E
ARHGAP21     1-0484-003chr10:
GAGAGCGTAAAGGAAAGGAAAGintergenicDe novo--Yuen2017 G
ARHGAP21     SP0041461chr10:
CTexonicDe novononsynonymous SNVNM_020824c.G559Ap.E187K16.275.117E-5Fu2022 E
ARHGAP21     2-1355-004chr10:
AATCAintronicDe novo--Yuen2017 G
ARHGAP21     AU3782302chr10:
GAintronicDe novo--Yuen2017 G
ARHGAP21     DEASD_3012_001chr10:
CTexonicDe novononsynonymous SNVNM_020824c.G4262Ap.R1421K35.0-Fu2022 E
ARHGAP21     SP0034176chr10:
CTexonicDe novononsynonymous SNVNM_020824c.G3043Ap.D1015N23.52.471E-5Fu2022 E
ARHGAP21     GEA491chr10:
CTTCexonicDe novoframeshift deletionNM_020824c.377_378delp.K126fs--Fu2022 E
ARHGAP21     12645.p1chr10:
AGexonicDe novononsynonymous SNVNM_020824c.T2444Cp.I815T13.0-Iossifov2012 E
Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Krupp2017 E
Satterstrom2020 E
ARHGAP21     1-0121-003chr10:
CTTTCTintronicDe novo--Yuen2017 G
ARHGAP21     Li2017:23258chr10:
GAexonicUnknownstopgainNM_020824c.C3442Tp.R1148X40.0-Li2017 T
Source Variant Information

, -


Paper alias:

No records found.
Paper Information
Variant source
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView