or
or
Exact

Results for "ARX"

Variant Events: 33

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
ARX     1-0564-003chrX:
25087678-25087698
TCTTCTTCTCCTTCTCCTTCTTCTTCTintergenicDe novo--Yuen2017 G
ARX     Schaaf2011:1chrX:
25031445-25031445
TGexonicUnknownnonsynonymous SNVNM_139058c.A667Cp.T223P5.873-Schaaf2011 T
ARX     AU3787302chrX:
25429082-25429089
ATTTTTTTATTTTTTTTintergenicDe novo--Yuen2017 G
ARX     2-1173-003chrX:
25141053-25141053
CTintergenicDe novo--Yuen2017 G
ARX     1-0439-003chrX:
25873191-25873191
CTintergenicDe novo--Yuen2017 G
ARX     5-0146-003chrX:
25936719-25936719
AGintergenicDe novo--Yuen2017 G
ARX     AU000704chrX:
25962978-25962978
CGintergenicDe novo--Yuen2017 G
ARX     AU3154301chrX:
25524206-25524206
CTintergenicDe novo--Yuen2017 G
ARX     2-1379-003chrX:
25789740-25789740
GAintergenicDe novo--Yuen2017 G
ARX     AU3787303chrX:
25429082-25429089
ATTTTTTTATTTTTTTTintergenicDe novo--Yuen2017 G
ARX     2-1408-003chrX:
26118628-26118628
TCintergenicDe novo--Yuen2017 G
ARX     AU4060306chrX:
25954835-25954835
GAintergenicDe novo--Yuen2017 G
ARX     Chen2021:23chrX:
25031807-25031807
GGGCCGCCexonicUnknownnonframeshift insertionNM_139058c.304_305insGGCGGCp.A102delinsGRP--Chen2021 GET
ARX     Chen2021:24chrX:
25031910-25031910
GTexonicMaternalnonsynonymous SNVNM_139058c.C202Ap.P68T12.32-Chen2021 GET
ARX     2-0198-005chrX:
25060126-25060126
AATintergenicDe novo--Yuen2017 G
ARX     1-0560-003chrX:
25712908-25712908
TCintergenicDe novo--Yuen2017 G
ARX     2-1276-003chrX:
25278407-25278425
AAGAGAGAGAGAGAGAGAGAAGAGAGAGAGAGAGAGintergenicDe novo--Yuen2017 G
ARX     2-1738-003chrX:
25868096-25868096
AGintergenicDe novo--Yuen2017 G
ARX     AU3881302chrX:
25567441-25567446
TTCTCTTTintergenicDe novo--Yuen2017 G
ARX     1-0522-003chrX:
25676066-25676066
CTintergenicDe novo--Yuen2017 G
ARX     AU4032305chrX:
26063037-26063037
TCintergenicDe novo--Yuen2017 G
ARX     AU3782303chrX:
26103818-26103840
AATATATAACATATTATATATAAAATATATAAintergenicDe novo--Yuen2017 G
ARX     1-0978-003chrX:
25564271-25564271
GAintergenicDe novo--Yuen2017 G
ARX     2-1407-003chrX:
25756571-25756571
CTintergenicDe novo--Yuen2017 G
ARX     AU3371302chrX:
25783612-25783612
GAintergenicDe novo--Yuen2017 G
ARX     14550.p1chrX:
25031277-25031277
CTexonicDe novononsynonymous SNVNM_139058c.G835Ap.A279T11.48-Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Satterstrom2020 E
Wilfert2021 G
ARX     1-0347-003chrX:
25547417-25547417
CTintergenicDe novo--Yuen2017 G
ARX     2-0238-003chrX:
25181141-25181141
TCintergenicDe novo--Yuen2017 G
ARX     Ishay2021:7chrX:
25025490-25025490
GCexonicMaternalnonsynonymous SNVNM_139058c.C1186Gp.P396A12.261.0E-4Ishay2021 E
ARX     Ishay2021:6chrX:
25031502-25031502
GTexonicMaternalnonsynonymous SNVNM_139058c.C610Ap.R204S8.719-Ishay2021 E
ARX     A0016chrX:
25031910-25031910
GTexonicMaternalnonsynonymous SNVNM_139058c.C202Ap.P68T12.32-Xiong2019 ET
ARX     2-1153-003chrX:
25303746-25303765
GAGACAGACAGACAGACAGAGAGACAGACAGACAGAintergenicDe novo--Yuen2017 G
ARX     AU061003chrX:
25344423-25344424
TCTintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More