or
or
Exact

Results for "YTHDC2"

Variant Events: 55

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
YTHDC2     2-0070-003chr5:
113046954-113046954
CAintergenicDe novo--Yuen2017 G
YTHDC2     2-1275-003chr5:
113486398-113486398
CGintergenicDe novo--Yuen2017 G
YTHDC2     1-0564-003chr5:
113004559-113004559
AGintergenicDe novo--Yuen2017 G
YTHDC2     7-0135-003chr5:
112866908-112866908
TAintronicDe novo--Yuen2017 G
YTHDC2     DEASD_0140_001chr5:
112860714-112860714
AGexonicDe novosynonymous SNVNM_022828c.A315Gp.K105K--DeRubeis2014 E
Kosmicki2017 E
Lim2017 E
Satterstrom2020 E
YTHDC2     Lim2017:5434chr5:
112868624-112868624
CTexonicDe novononsynonymous SNVNM_022828c.C724Tp.R242C21.4-Lim2017 E
YTHDC2     DEASD_0178_001chr5:
112899557-112899557
CTexonicDe novononsynonymous SNVNM_022828c.C2444Tp.T815I12.09-DeRubeis2014 E
Kosmicki2017 E
Lim2017 E
Satterstrom2020 E
YTHDC2     1-0252-003chr5:
112894580-112894580
TCintronicDe novo--Yuen2017 G
YTHDC2     AU3053301chr5:
113064847-113064847
CTintergenicDe novo--Yuen2017 G
YTHDC2     1-0150-004chr5:
113419976-113419976
ATintergenicDe novo--Yuen2017 G
YTHDC2     1-0282-003chr5:
113522488-113522488
GAintergenicDe novo--Yuen2017 G
YTHDC2     2-0129-004chr5:
113631555-113631555
TAintergenicDe novo--Yuen2017 G
YTHDC2     AU4215302chr5:
113355814-113355814
TCintergenicDe novo--Yuen2017 G
YTHDC2     2-1485-004chr5:
112920074-112920074
AGexonicDe novosynonymous SNVNM_022828c.A3723Gp.K1241K--Yuen2017 G
YTHDC2     5-0099-003chr5:
113169699-113169699
AGintergenicDe novo--Yuen2017 G
YTHDC2     1-0898-003chr5:
113451263-113451263
CTintergenicDe novo--Yuen2017 G
YTHDC2     2-1368-003chr5:
113498785-113498785
GAintergenicDe novo--Yuen2016 G
Yuen2017 G
YTHDC2     AU3913301chr5:
113315808-113315808
GAintergenicDe novo--Yuen2017 G
YTHDC2     2-1485-004chr5:
113068805-113068805
AGintergenicDe novo--Yuen2017 G
YTHDC2     3-0246-000chr5:
113512600-113512616
GTCTCTCTCTCTCTCTCGTCTCTCTCTCTCTCintergenicDe novo--Yuen2017 G
YTHDC2     AU2427302chr5:
113480286-113480286
TCintergenicDe novo--Yuen2017 G
YTHDC2     2-0208-004chr5:
112894580-112894580
TCintronicDe novo--Yuen2017 G
YTHDC2     2-1356-003chr5:
112959850-112959851
CACintergenicDe novo--Yuen2017 G
YTHDC2     1-0320-004chr5:
113270412-113270412
CTintergenicDe novo--Yuen2017 G
YTHDC2     2-1460-003chr5:
113035469-113035469
GTintergenicDe novo--Yuen2017 G
YTHDC2     AU4273304chr5:
113301166-113301166
TCintergenicDe novo--Yuen2017 G
YTHDC2     5-0017-003chr5:
113550033-113550033
GAintergenicDe novo--Yuen2017 G
YTHDC2     2-1338-003chr5:
113371398-113371398
TCintergenicDe novo--Yuen2017 G
YTHDC2     3-0469-000chr5:
113540280-113540280
ATintergenicDe novo--Yuen2017 G
YTHDC2     2-1485-003chr5:
112920074-112920074
AGexonicDe novosynonymous SNVNM_022828c.A3723Gp.K1241K--Yuen2017 G
YTHDC2     2-1212-003chr5:
113098979-113098979
TCintergenicDe novo--Yuen2017 G
YTHDC2     1-0547-003chr5:
113192951-113192951
CAintergenicDe novo--Yuen2017 G
YTHDC2     2-1485-003chr5:
113068805-113068805
AGintergenicDe novo--Yuen2017 G
YTHDC2     JASD_Fam0043chr5:
112878139-112878139
AGexonicDe novosynonymous SNVNM_022828c.A1434Gp.L478L--Takata2018 E
YTHDC2     1-0546-003chr5:
113554446-113554446
AGintergenicDe novo--Yuen2017 G
YTHDC2     2-1508-004chr5:
113420220-113420220
TGintergenicDe novo--Yuen2017 G
YTHDC2     AU012803chr5:
113388186-113388186
TAintergenicDe novo--Yuen2017 G
YTHDC2     5-0071-003chr5:
113031362-113031362
GAintergenicDe novo--Yuen2017 G
YTHDC2     2-1342-003chr5:
113624451-113624451
AGintergenicDe novo--Yuen2016 G
Yuen2017 G
YTHDC2     AU1987301chr5:
113120407-113120407
GCintergenicDe novo--Yuen2017 G
YTHDC2     AU026412chr5:
113500824-113500824
CTintergenicDe novo--Yuen2017 G
YTHDC2     AU3779304chr5:
113289647-113289647
ATintergenicDe novo--Yuen2017 G
YTHDC2     AU002406chr5:
113585183-113585183
CAintergenicDe novo--Yuen2017 G
YTHDC2     2-1375-003chr5:
113506947-113506947
AGintergenicDe novo--Yuen2016 G
Yuen2017 G
YTHDC2     2-1086-004chr5:
112991256-112991256
AGintergenicDe novo--Yuen2017 G
YTHDC2     AU1988302chr5:
113589563-113589563
GAintergenicDe novo--Yuen2017 G
YTHDC2     7-0008-003chr5:
112907536-112907536
TCintronicDe novo--Yuen2017 G
YTHDC2     AU076704chr5:
113603243-113603243
TCintergenicDe novo--Yuen2017 G
YTHDC2     2-0202-004chr5:
113249771-113249782
GCTTGGTTCAGTGintergenicDe novo--Yuen2017 G
YTHDC2     2-1005-003chr5:
112910079-112910082
ATCTATCTCTintronicDe novo--Yuen2017 G
YTHDC2     11788.p1chr5:
112868624-112868624
CTexonicDe novononsynonymous SNVNM_022828c.C724Tp.R242C21.4-Iossifov2014 E
Ji2016 E
Kosmicki2017 E
O’Roak2012b E
Satterstrom2020 E
YTHDC2     2-1325-003chr5:
113041305-113041305
GAintergenicDe novo--Yuen2017 G
YTHDC2     AU1988302chr5:
113589294-113589294
CTintergenicDe novo--Yuen2017 G
YTHDC2     2-1365-003chr5:
113488895-113488895
GAintergenicDe novo--Yuen2016 G
Yuen2017 G
YTHDC2     2-1391-004chr5:
113642098-113642098
GAintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More